Product Details

SNP ID: rs955462
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:6755827 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GGAGAGGCCTGGCCTCAGGCTGCCA[C/G]CCTCAGGGAGGTAGATGCGGCTGTG
Phenotype: MIM: 606717
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: XAF1 PubMed Links
Additional Information: For this assay, SNP(s) [rs3785790,rs78249496] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.