Product Details

SNP ID: rs10902178
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:612843 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCGTCTGTCAGTGACCCGGCGTGTG[G/T]CCTCCCCTCCCCCTCCCCAGGCTCT
Phenotype: MIM: 606839 MIM: 605047 MIM: 611780
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CDHR5 PubMed Links

Gene Details

Gene: CDHR5
Gene Name: cadherin related family member 5

There are no transcripts associated with this gene.

Gene: IRF7
Gene Name: interferon regulatory factor 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001572.3		Intron			NP_001563.2
NM_004029.2		Intron			NP_004020.1
NM_004031.2		Intron			NP_004022.2
XM_005252906.3		Intron			XP_005252963.1
XM_005252907.3		Intron			XP_005252964.1
XM_005252909.3		Intron			XP_005252966.1
XM_011520066.2		Intron			XP_011518368.1
XM_017017674.1		Intron			XP_016873163.1

Gene: PHRF1
Gene Name: PHD and ring finger domains 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286581.1		Intron			NP_001273510.1
NM_001286582.1		Intron			NP_001273511.1
NM_001286583.1		Intron			NP_001273512.1
NM_020901.3		Intron			NP_065952.2
XM_005253025.4		Intron			XP_005253082.1
XM_005253027.3		Intron			XP_005253084.1
XM_011520236.2		Intron			XP_011518538.1
XM_011520237.2		Intron			XP_011518539.1

View Full Product Details