Product Details

SNP ID: rs34029821
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:53048206 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GTGCGAGTGCCACAGGATGGGAGGG[A/G]CTCACAGCCACAGTGGATCCTGACC
Phenotype: MIM: 603928 MIM: 607717
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EIF4B PubMed Links

Gene Details

Gene: EIF4B
Gene Name: eukaryotic translation initiation factor 4B

There are no transcripts associated with this gene.

Gene: LOC283335
Gene Name: uncharacterized LOC283335

There are no transcripts associated with this gene.

Gene: MIR6757
Gene Name: microRNA 6757

There are no transcripts associated with this gene.

Gene: TNS2
Gene Name: tensin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015319.2	617	Intron			NP_056134.2
NM_170754.2	617	Intron			NP_736610.2
NM_198316.1	617	Intron			NP_938072.1
XM_006719302.3	617	UTR 5			XP_006719365.1
XM_006719303.1	617	Intron			XP_006719366.1
XM_011538079.1	617	Intron			XP_011536381.1
XM_017019088.1	617	Intron			XP_016874577.1
XM_017019089.1	617	Intron			XP_016874578.1

View Full Product Details