Product Details

SNP ID: rs11613325
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:132843252 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTCTGAGATTTCAGGAAAGGAAAC[A/G]CATGTTTAACTAAAAACCCAACTGA
Phenotype: MIM: 605209
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHFR PubMed Links

Gene Details

Gene: CHFR
Gene Name: checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase

Transcript Accession	SNP Type	Protein ID
NM_001161344.1	Intron	NP_001154816.1
NM_001161345.1	Intron	NP_001154817.1
NM_001161346.1	Intron	NP_001154818.1
NM_001161347.1	Intron	NP_001154819.1
NM_018223.2	Intron	NP_060693.2