Product Details

SNP ID: rs2088504
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:11725880 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CATGTGGGCGTGGGGTGGAATGGCT[C/T]TAAGATGGCCACAACCAATGACACG
Phenotype: MIM: 614948
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: TAMM41 PubMed Links

Gene Details

Gene: TAMM41
Gene Name: TAM41 mitochondrial translocator assembly and maintenance homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284401.1		Intron			NP_001271330.1
NM_001321294.1		Intron			NP_001308223.1
NM_001321295.1		Intron			NP_001308224.1
NM_138807.3		Intron			NP_620162.1
XM_005264873.3		Intron			XP_005264930.1
XM_005264875.3		Intron			XP_005264932.1
XM_017005725.1		Intron			XP_016861214.1
XM_017005726.1		Intron			XP_016861215.1
XM_017005727.1		Intron			XP_016861216.1
XM_017005728.1		Intron			XP_016861217.1

Gene: VGLL4
Gene Name: vestigial like family member 4

There are no transcripts associated with this gene.

View Full Product Details