Product Details

SNP ID: rs12482041
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:44654648 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGACAGGTGGGGGGCGCAGAGGA[C/G]AGGGCTGGTCTGGAGCCTGCTTCCT
Phenotype: MIM: 612920
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: KRTAP10-11 PubMed Links

Gene Details

Gene: KRTAP10-11
Gene Name: keratin associated protein 10-11

There are no transcripts associated with this gene.

Gene: KRTAP12-3
Gene Name: keratin associated protein 12-3

There are no transcripts associated with this gene.

Gene: KRTAP12-4
Gene Name: keratin associated protein 12-4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198698.1	12	UTR 5			NP_941971.1

Gene: TSPEAR
Gene Name: thrombospondin type laminin G domain and EAR repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272037.1	12	Intron			NP_001258966.1
NM_144991.2	12	Intron			NP_659428.2

View Full Product Details