Product Details
- SNP ID
-
rs1048440
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:101552488 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCAACTCTGCCCTGTCATCCTGGA[A/G]CCACAGTCTGGTGAGGAGGATTGAG
- Phenotype
-
MIM: 601038
MIM: 608523
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DIO3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs537884248] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DIO3
- Gene Name
- deiodinase, iodothyronine, type III
There are no transcripts associated with this gene.
- Gene
- DIO3OS
- Gene Name
- DIO3 opposite strand/antisense RNA (head to head)
There are no transcripts associated with this gene.
- Gene
- MIR1247
- Gene Name
- microRNA 1247
There are no transcripts associated with this gene.
View Full Product Details