Product Details

SNP ID: rs703683
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:105173357 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TATTACAAAGATAATAATAGTCTGT[C/T]GAACTTAGTTACAGTTAAACACACT
Phenotype: MIM: 606231 MIM: 615748
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: APPL2 PubMed Links

Gene Details

Gene: APPL2
Gene Name: adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001251904.1	4285	UTR 3			NP_001238833.1
NM_001251905.1	4285	UTR 3			NP_001238834.1
NM_018171.3	4285	UTR 3			NP_060641.2
XM_006719472.1	4285	UTR 3			XP_006719535.1
XM_011538530.2	4285	UTR 3			XP_011536832.1
XM_011538531.2	4285	UTR 3			XP_011536833.1
XM_011538532.2	4285	UTR 3			XP_011536834.1
XM_017019551.1	4285	UTR 3			XP_016875040.1
XM_017019552.1	4285	UTR 3			XP_016875041.1
XM_017019553.1	4285	UTR 3			XP_016875042.1
XM_017019554.1	4285	UTR 3			XP_016875043.1

Gene: KIAA1033
Gene Name: KIAA1033

There are no transcripts associated with this gene.

View Full Product Details