Product Details

SNP ID: rs1275533
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27212382 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGAACGGAAAATGGCGCCTCACG[A/G]CCCGGGTAGTCTTACGACCCTGGTG
Phenotype: MIM: 114010 MIM: 604024
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATRAID PubMed Links

Gene Details

Gene: ATRAID
Gene Name: all-trans retinoic acid induced differentiation factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001170795.1	352	Missense Mutation	GAC,GGC	D5G	NP_001164266.1
NM_016085.4	352	UTR 5			NP_057169.2
NM_080592.3	352	Missense Mutation	GAC,GGC	D60G	NP_542159.3

Gene: CAD
Gene Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

There are no transcripts associated with this gene.

Gene: SLC5A6
Gene Name: solute carrier family 5 member 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021095.2	352	Intron			NP_066918.2
XM_006712128.1	352	Intron			XP_006712191.1
XM_006712129.1	352	Intron			XP_006712192.1
XM_006712130.1	352	Intron			XP_006712193.1
XM_011533146.2	352	Intron			XP_011531448.1
XM_017005216.1	352	Intron			XP_016860705.1

View Full Product Details