Product Details

SNP ID

rs1536857

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.9:474053 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGTTAATGAAGAAGCTTTCCCCACA[A/T]GATGGCTCCTCACAAGAAATACTAT

Phenotype

MIM: 611432 MIM: 607704

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

DOCK8 PubMed Links

Additional Information

For this assay, SNP(s) [rs150886772] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DOCK8

Gene Name

dedicator of cytokinesis 8

There are no transcripts associated with this gene.

Gene

KANK1

Gene Name

KN motif and ankyrin repeat domains 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256876.1		Intron			NP_001243805.1
NM_001256877.1		Intron			NP_001243806.1
NM_015158.3		Intron			NP_055973.2
NM_153186.4		Intron			NP_694856.1
XM_005251411.2		Intron			XP_005251468.1
XM_005251414.3		Intron			XP_005251471.1
XM_005251415.2		Intron			XP_005251472.1
XM_005251416.2		Intron			XP_005251473.1
XM_005251417.3		Intron			XP_005251474.1
XM_005251418.2		Intron			XP_005251475.1
XM_005251419.2		Intron			XP_005251476.1
XM_006716743.2		Intron			XP_006716806.1
XM_011517819.1		Intron			XP_011516121.1
XM_011517820.1		Intron			XP_011516122.1
XM_011517821.1		Intron			XP_011516123.1
XM_017014511.1		Intron			XP_016870000.1
XM_017014512.1		Intron			XP_016870001.1
XM_017014513.1		Intron			XP_016870002.1
XM_017014514.1		Intron			XP_016870003.1
XM_017014515.1		Intron			XP_016870004.1
XM_017014516.1		Intron			XP_016870005.1
XM_017014517.1		Intron			XP_016870006.1
XM_017014518.1		Intron			XP_016870007.1
XM_017014519.1		Intron			XP_016870008.1
XM_017014520.1		Intron			XP_016870009.1
XM_017014521.1		Intron			XP_016870010.1
XM_017014522.1		Intron			XP_016870011.1
XM_017014523.1		Intron			XP_016870012.1
XM_017014524.1		Intron			XP_016870013.1
XM_017014525.1		Intron			XP_016870014.1
XM_017014526.1		Intron			XP_016870015.1
XM_017014527.1		Intron			XP_016870016.1
XM_017014528.1		Intron			XP_016870017.1
XM_017014529.1		Intron			XP_016870018.1
XM_017014530.1		Intron			XP_016870019.1
XM_017014531.1		Intron			XP_016870020.1
XM_017014532.1		Intron			XP_016870021.1
XM_017014533.1		Intron			XP_016870022.1
XM_017014534.1		Intron			XP_016870023.1
XM_017014535.1		Intron			XP_016870024.1
XM_017014536.1		Intron			XP_016870025.1
XM_017014537.1		Intron			XP_016870026.1
XM_017014538.1		Intron			XP_016870027.1
XM_017014539.1		Intron			XP_016870028.1
XM_017014540.1		Intron			XP_016870029.1
XM_017014541.1		Intron			XP_016870030.1
XM_017014542.1		Intron			XP_016870031.1

View Full Product Details