Product Details

SNP ID

rs1046585

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.10:60026622 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCCTCAGTCTTGATGGAACTCCAGG[A/G]TGATACCAAATGAACAGCGAGGAAC

Phenotype

MIM: 600465

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ANK3 PubMed Links

Additional Information

For this assay, SNP(s) [rs114693358,rs78682113] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ANK3

Gene Name

ankyrin 3, node of Ranvier (ankyrin G)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001149.3	16804	UTR 3			NP_001140.2
NM_001204403.1	16804	UTR 3			NP_001191332.1
NM_001204404.1	16804	UTR 3			NP_001191333.1
NM_001320874.1	16804	UTR 3			NP_001307803.1
NM_020987.4	16804	UTR 3			NP_066267.2
XM_005269715.3	16804	Intron			XP_005269772.1
XM_006717796.3	16804	Intron			XP_006717859.1
XM_006717802.3	16804	Intron			XP_006717865.1
XM_011539708.2	16804	Intron			XP_011538010.1
XM_011539709.2	16804	Intron			XP_011538011.1
XM_017016110.1	16804	Intron			XP_016871599.1
XM_017016111.1	16804	Intron			XP_016871600.1
XM_017016112.1	16804	Intron			XP_016871601.1
XM_017016113.1	16804	Intron			XP_016871602.1
XM_017016114.1	16804	Intron			XP_016871603.1
XM_017016115.1	16804	Intron			XP_016871604.1
XM_017016116.1	16804	Intron			XP_016871605.1
XM_017016117.1	16804	Intron			XP_016871606.1
XM_017016118.1	16804	Intron			XP_016871607.1
XM_017016119.1	16804	Intron			XP_016871608.1
XM_017016120.1	16804	Intron			XP_016871609.1
XM_017016121.1	16804	Intron			XP_016871610.1
XM_017016122.1	16804	Intron			XP_016871611.1
XM_017016123.1	16804	Intron			XP_016871612.1
XM_017016124.1	16804	Intron			XP_016871613.1
XM_017016125.1	16804	Intron			XP_016871614.1
XM_017016126.1	16804	Intron			XP_016871615.1
XM_017016127.1	16804	Intron			XP_016871616.1
XM_017016128.1	16804	Intron			XP_016871617.1
XM_017016129.1	16804	Intron			XP_016871618.1
XM_017016130.1	16804	Intron			XP_016871619.1
XM_017016131.1	16804	Intron			XP_016871620.1
XM_017016132.1	16804	Intron			XP_016871621.1
XM_017016133.1	16804	Intron			XP_016871622.1
XM_017016134.1	16804	Intron			XP_016871623.1
XM_017016135.1	16804	Intron			XP_016871624.1
XM_017016136.1	16804	Intron			XP_016871625.1
XM_017016137.1	16804	Intron			XP_016871626.1
XM_017016138.1	16804	Intron			XP_016871627.1
XM_017016139.1	16804	Intron			XP_016871628.1
XM_017016140.1	16804	Intron			XP_016871629.1
XM_017016141.1	16804	Intron			XP_016871630.1
XM_017016142.1	16804	Intron			XP_016871631.1
XM_017016143.1	16804	Intron			XP_016871632.1
XM_017016144.1	16804	Intron			XP_016871633.1
XM_017016145.1	16804	Intron			XP_016871634.1
XM_017016146.1	16804	Intron			XP_016871635.1
XM_017016147.1	16804	Intron			XP_016871636.1
XM_017016148.1	16804	Intron			XP_016871637.1
XM_017016149.1	16804	Intron			XP_016871638.1
XM_017016150.1	16804	Intron			XP_016871639.1

View Full Product Details