Product Details

SNP ID: rs6531
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33195674 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCGAACATCAATGGATCGGTGTGA[A/G]AAGGAGGCAATGAGGAGTTCATTCC
Phenotype: MIM: 120290 MIM: 601417 MIM: 180246 MIM: 601416
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: COL11A2 PubMed Links

Gene Details

Gene: COL11A2
Gene Name: collagen type XI alpha 2

There are no transcripts associated with this gene.

Gene: HSD17B8
Gene Name: hydroxysteroid 17-beta dehydrogenase 8

There are no transcripts associated with this gene.

Gene: RXRB
Gene Name: retinoid X receptor beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270401.1	1322	Silent Mutation	TTC,TTT	F384F	NP_001257330.1
NM_001291989.1	1322	Silent Mutation	TTC,TTT	F194F	NP_001278918.1
NM_021976.4	1322	Silent Mutation	TTC,TTT	F384F	NP_068811.1
XM_005249278.2	1322	Silent Mutation	TTC,TTT	F288F	XP_005249335.1
XM_011514796.2	1322	Silent Mutation	TTC,TTT	F267F	XP_011513098.1
XM_017011176.1	1322	Silent Mutation	TTC,TTT	F261F	XP_016866665.1

Gene: SLC39A7
Gene Name: solute carrier family 39 member 7

There are no transcripts associated with this gene.

View Full Product Details