Product Details

SNP ID: rs12000
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:28259658 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TCGACCTCGTATAGTGGATATCGCT[A/G]CCATCGTCACTGCTATGCAGAAGAA
Phenotype: MIM: 611643 MIM: 616474
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NKAPL PubMed Links

Gene Details

Gene: NKAPL
Gene Name: NFKB activating protein like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001007531.2	362	Missense Mutation	TAC,TGC	Y96C	NP_001007532.1

Gene: ZKSCAN4
Gene Name: zinc finger with KRAB and SCAN domains 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304506.1	362	Intron			NP_001291435.1
NM_019110.4	362	Intron			NP_061983.2
XM_005249095.3	362	Intron			XP_005249152.1
XM_005249097.3	362	Intron			XP_005249154.1
XM_005249098.3	362	Intron			XP_005249155.1
XM_005249100.4	362	Intron			XP_005249157.2
XM_006715095.3	362	Intron			XP_006715158.1
XM_011514588.2	362	Intron			XP_011512890.1
XM_011514589.2	362	Intron			XP_011512891.1
XM_017010844.1	362	Intron			XP_016866333.1

Gene: ZSCAN26
Gene Name: zinc finger and SCAN domain containing 26

There are no transcripts associated with this gene.

View Full Product Details