Product Details

SNP ID: rs11236
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219172375 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTCACCAAGCGGAAGCTCTCCCTGG[C/T]GGCATCACTGTCCTGGCCAAGCAGC
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CNPPD1 PubMed Links

Gene Details

Gene: CNPPD1
Gene Name: cyclin Pas1/PHO80 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321389.1	1872	UTR 3			NP_001308318.1
NM_001321390.1	1872	UTR 3			NP_001308319.1
NM_001321391.1	1872	UTR 3			NP_001308320.1
NM_015680.5	1872	UTR 3			NP_056495.3

Gene: FAM134A
Gene Name: family with sequence similarity 134 member A

There are no transcripts associated with this gene.

Gene: SLC23A3
Gene Name: solute carrier family 23 member 3

There are no transcripts associated with this gene.

View Full Product Details