Product Details

SNP ID
rs2272501
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.12:81262082 on Build GRCh38
Set Membership
HapMap Validated
Context Sequence [VIC/FAM]
GGGCTTTAGAGGGACTTGGATGATT[C/G]AGTACAAGATTTCAGATGAGAAAGA
Phenotype
MIM: 614356 MIM: 603143
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
ACSS3 PubMed Links
Additional Information
For this assay, SNP(s) [rs10862276] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ACSS3
Gene Name
acyl-CoA synthetase short-chain family member 3
There are no transcripts associated with this gene.

Gene
PPFIA2
Gene Name
PTPRF interacting protein alpha 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001220473.2 Intron NP_001207402.1
NM_001220474.2 Intron NP_001207403.1
NM_001220475.2 Intron NP_001207404.1
NM_001220476.2 Intron NP_001207405.1
NM_001220477.2 Intron NP_001207406.1
NM_001220478.2 Intron NP_001207407.1
NM_001220479.2 Intron NP_001207408.1
NM_001220480.2 Intron NP_001207409.1
NM_001282536.1 Intron NP_001269465.1
NM_003625.4 Intron NP_003616.2
XM_006719670.3 Intron XP_006719733.1
XM_011538906.2 Intron XP_011537208.1
XM_011538907.2 Intron XP_011537209.1
XM_017020079.1 Intron XP_016875568.1
XM_017020080.1 Intron XP_016875569.1
XM_017020081.1 Intron XP_016875570.1
XM_017020082.1 Intron XP_016875571.1
XM_017020083.1 Intron XP_016875572.1
XM_017020084.1 Intron XP_016875573.1
XM_017020085.1 Intron XP_016875574.1
XM_017020086.1 Intron XP_016875575.1
XM_017020087.1 Intron XP_016875576.1
XM_017020088.1 Intron XP_016875577.1
XM_017020089.1 Intron XP_016875578.1
XM_017020090.1 Intron XP_016875579.1
XM_017020091.1 Intron XP_016875580.1
XM_017020092.1 Intron XP_016875581.1
XM_017020093.1 Intron XP_016875582.1
XM_017020094.1 Intron XP_016875583.1
XM_017020095.1 Intron XP_016875584.1
XM_017020096.1 Intron XP_016875585.1
XM_017020097.1 Intron XP_016875586.1
XM_017020098.1 Intron XP_016875587.1
XM_017020099.1 Intron XP_016875588.1
XM_017020100.1 Intron XP_016875589.1
XM_017020101.1 Intron XP_016875590.1
XM_017020102.1 Intron XP_016875591.1
XM_017020103.1 Intron XP_016875592.1
XM_017020104.1 Intron XP_016875593.1
XM_017020105.1 Intron XP_016875594.1
XM_017020106.1 Intron XP_016875595.1
XM_017020107.1 Intron XP_016875596.1
XM_017020108.1 Intron XP_016875597.1
XM_017020109.1 Intron XP_016875598.1
XM_017020110.1 Intron XP_016875599.1
XM_017020111.1 Intron XP_016875600.1
XM_017020112.1 Intron XP_016875601.1
XM_017020113.1 Intron XP_016875602.1
XM_017020114.1 Intron XP_016875603.1
XM_017020115.1 Intron XP_016875604.1
XM_017020116.1 Intron XP_016875605.1
XM_017020117.1 Intron XP_016875606.1
XM_017020118.1 Intron XP_016875607.1
XM_017020119.1 Intron XP_016875608.1
XM_017020120.1 Intron XP_016875609.1

View Full Product Details