Product Details

SNP ID: rs144944954
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144523275 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGAGGCTGCTGTGGGATACGTCCA[C/G]GAGACTCTGGAGCGCCAGGCGCGGG
Phenotype: MIM: 615880 MIM: 603780
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ARHGAP39 PubMed Links

Gene Details

Gene: ARHGAP39
Gene Name: Rho GTPase activating protein 39

There are no transcripts associated with this gene.

Gene: C8orf82
Gene Name: chromosome 8 open reading frame 82

There are no transcripts associated with this gene.

Gene: LRRC14
Gene Name: leucine rich repeat containing 14

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272036.1	874	UTR 3			NP_001258965.1
NM_014665.3	874	UTR 3			NP_055480.1
XM_005272358.4	874	UTR 3			XP_005272415.1
XM_005272359.4	874	UTR 3			XP_005272416.1
XM_005272360.4	874	UTR 3			XP_005272417.1
XM_017014005.1	874	UTR 3			XP_016869494.1

Gene: LRRC24
Gene Name: leucine rich repeat containing 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024678.3	874	Missense Mutation	CTG,GTG	L248V	NP_001019849.2

Gene: RECQL4
Gene Name: RecQ like helicase 4

There are no transcripts associated with this gene.

View Full Product Details