Product Details

SNP ID: rs121918128
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136430391 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACAGGACAGATGTCACCCTTGTGG[T/C]GGCTTCTGTACAAGACGCGGTCCTT
Phenotype: MIM: 613037 MIM: 613036 MIM: 612854
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: INPP5E PubMed Links

Gene Details

Gene: INPP5E
Gene Name: inositol polyphosphate-5-phosphatase E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318502.1	2130	Missense Mutation	CAC,CGC	H562R	NP_001305431.1
NM_019892.5	2130	Missense Mutation	CAC,CGC	H563R	NP_063945.2
XM_017014926.1	2130	Missense Mutation	CAC,CGC	H563R	XP_016870415.1

Gene: PMPCA
Gene Name: peptidase, mitochondrial processing alpha subunit

There are no transcripts associated with this gene.

Gene: SEC16A
Gene Name: SEC16 homolog A, endoplasmic reticulum export factor

There are no transcripts associated with this gene.

View Full Product Details