Product Details

SNP ID: rs201929780
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:64150919 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCACTTCTCTCTCTCCAAGTTTTGG[C/T]CGAGCTTTCAGCTCCACATGTGGTG
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: SNHG25 PubMed Links

Gene Details

Gene: SNHG25
Gene Name: small nucleolar RNA host gene 25

There are no transcripts associated with this gene.

Gene: SNORA50C
Gene Name: small nucleolar RNA, H/ACA box 50C

There are no transcripts associated with this gene.

Gene: SNORD104
Gene Name: small nucleolar RNA, C/D box 104

There are no transcripts associated with this gene.

Gene: TEX2
Gene Name: testis expressed 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001288732.1	3328	Silent Mutation	CGA,CGG	R1061R	NP_001275661.1
NM_001288733.1	3328	Silent Mutation	CGA,CGG	R1061R	NP_001275662.1
NM_018469.4	3328	Silent Mutation	CGA,CGG	R1068R	NP_060939.3
XM_011524998.1	3328	Silent Mutation	CGA,CGG	R1068R	XP_011523300.1
XM_011524999.1	3328	Silent Mutation	CGA,CGG	R1068R	XP_011523301.1
XM_011525000.1	3328	Silent Mutation	CGA,CGG	R1066R	XP_011523302.1
XM_017024846.1	3328	Silent Mutation	CGA,CGG	R1059R	XP_016880335.1
XM_017024847.1	3328	Intron			XP_016880336.1

View Full Product Details