Product Details

SNP ID: rs2002136
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:47945523 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CATGCCGGAGGCCTCCTCTCCCTGT[C/T]CTGATGGCTGGCTGTGGATTCTCTT
Phenotype: MIM: 603287
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PNPO PubMed Links

Gene Details

Gene: PNPO
Gene Name: pyridoxamine 5'-phosphate oxidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018129.3		Intron			NP_060599.1
XM_005257500.3		Intron			XP_005257557.1
XM_011524968.2		Intron			XP_011523270.1
XM_017024813.1		Intron			XP_016880302.1

Gene: PRR15L
Gene Name: proline rich 15 like

There are no transcripts associated with this gene.

Gene: SP2-AS1
Gene Name: SP2 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details