Product Details

SNP ID: rs11575939
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:39451976 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCGGGACTGCCGGAGCCCAGTGGA[C/G]CCCTGGGCTGCTGCCAGCCCCGACC
Phenotype: MIM: 602230
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LCA5L PubMed Links

Gene Details

Gene: LCA5L
Gene Name: LCA5L, lebercilin like

There are no transcripts associated with this gene.

Gene: MIR6508
Gene Name: microRNA 6508

There are no transcripts associated with this gene.

Gene: SH3BGR
Gene Name: SH3 domain binding glutamate rich protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001713.1	123	Intron			NP_001001713.1
NM_001317740.1	123	Missense Mutation	GAC,GAG	D23E	NP_001304669.1
NM_001317741.1	123	Intron			NP_001304670.1
NM_001317742.1	123	Intron			NP_001304671.1
NM_007341.2	123	Missense Mutation	GAC,GAG	D23E	NP_031367.1

Gene: WRB-SH3BGR
Gene Name: WRB-SH3BGR readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317744.1	123	Intron			NP_001304673.1

View Full Product Details