Product Details

SNP ID: rs34075659
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24172747 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACTCGCGGCAGCCGGTTGGTGAAG[C/T]GCGAATACCTGAGGGTGAATGTGGT
Phenotype: MIM: 147574 MIM: 608193
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IPO4 PubMed Links

Gene Details

Gene: IPO4
Gene Name: importin 4

There are no transcripts associated with this gene.

Gene: IRF9
Gene Name: interferon regulatory factor 9

There are no transcripts associated with this gene.

Gene: REC8
Gene Name: REC8 meiotic recombination protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001048205.1	791	Missense Mutation	CGC,TGC	R31C	NP_001041670.1
NM_005132.2	791	Missense Mutation	CGC,TGC	R31C	NP_005123.2
XM_011537421.1	791	Missense Mutation	CGC,TGC	R31C	XP_011535723.1
XM_017021841.1	791	UTR 5			XP_016877330.1

View Full Product Details