Product Details

SNP ID: rs3760685
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:8324127 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CACTGGGGTTTTGCTGCTTTCACAT[A/C]AAATCCCAGCCCCTGCCAGGCGCTC
Phenotype: MIM: 614611 MIM: 602139 MIM: 603685
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: KANK3 PubMed Links

Gene Details

Gene: KANK3
Gene Name: KN motif and ankyrin repeat domains 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198471.2		Intron			NP_940873.2
XM_006722718.3		Intron			XP_006722781.1
XM_011527884.2		Intron			XP_011526186.1
XM_017026563.1		Intron			XP_016882052.1

Gene: NDUFA7
Gene Name: NADH:ubiquinone oxidoreductase subunit A7

There are no transcripts associated with this gene.

Gene: RPS28
Gene Name: ribosomal protein S28

There are no transcripts associated with this gene.

View Full Product Details