Product Details

SNP ID: rs5761665
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.22:26661475 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTATTGTATACTCAAAGGTGTGGAG[G/T]AGATGATGAGTAGTAACTAACCCTA
Phenotype: MIM: 611082
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: MIAT PubMed Links
Additional Information: For this assay, SNP(s) [rs1981493] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.