Product Details

SNP ID: rs16979054
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:46291757 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATGTTGAGCTAACACAGACCTGCTG[A/G]ATCAGCTTCTTTCTGAGCTGCCAGA
Phenotype: MIM: 603294
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C21orf58 PubMed Links

Gene Details

Gene: C21orf58
Gene Name: chromosome 21 open reading frame 58

There are no transcripts associated with this gene.

Gene: MCM3AP
Gene Name: minichromosome maintenance complex component 3 associated protein

There are no transcripts associated with this gene.

Gene: YBEY
Gene Name: ybeY metallopeptidase (putative)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006114.2	764	UTR 3			NP_001006114.1
NM_001314022.1	764	Intron			NP_001300951.1
NM_001314023.1	764	Intron			NP_001300952.1
NM_001314024.1	764	Intron			NP_001300953.1
NM_001314025.1	764	Intron			NP_001300954.1
NM_001314026.1	764	UTR 3			NP_001300955.1
NM_058181.2	764	Intron			NP_478061.1
XM_005261156.3	764	Intron			XP_005261213.2
XM_011529629.2	764	Intron			XP_011527931.1
XM_011529630.2	764	Intron			XP_011527932.1
XM_011529631.2	764	Intron			XP_011527933.1
XM_011529633.2	764	Intron			XP_011527935.1
XM_011529634.2	764	Intron			XP_011527936.2
XM_011529635.2	764	Intron			XP_011527937.1
XM_017028394.1	764	Intron			XP_016883883.1
XM_017028395.1	764	Intron			XP_016883884.1
XM_017028396.1	764	Intron			XP_016883885.1

View Full Product Details