Product Details

SNP ID: rs3207600
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64230922 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCAACCCTCCCTCCCGGCTCCTCG[A/G]AGCGGCCGCCGGGCAGCGGTGAGTT
Phenotype: MIM: 604189 MIM: 607901 MIM: 610470 MIM: 601398
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC4 PubMed Links

Gene Details

Gene: DNAJC4
Gene Name: DnaJ heat shock protein family (Hsp40) member C4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001307980.1	491	Missense Mutation	GAA,GGA	E23G	NP_001294909.1
NM_001307981.1	491	Missense Mutation	GAA,GGA	E23G	NP_001294910.1
NM_005528.3	491	Missense Mutation	GAA,GGA	E23G	NP_005519.2

Gene: FERMT3
Gene Name: fermitin family member 3

There are no transcripts associated with this gene.

Gene: NUDT22
Gene Name: nudix hydrolase 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128612.2	491	Intron			NP_001122084.1
NM_001128613.2	491	Intron			NP_001122085.1
NM_001271831.1	491	Intron			NP_001258760.1
NM_032344.3	491	Intron			NP_115720.1

Gene: TRPT1
Gene Name: tRNA phosphotransferase 1

There are no transcripts associated with this gene.

Gene: VEGFB
Gene Name: vascular endothelial growth factor B

There are no transcripts associated with this gene.

View Full Product Details