Product Details
- SNP ID
-
rs77738503
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:104598604 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTTTGTCAGTGGCATCCAAGTCATC[T/C]GAATTAAGTGTCTCTTGAGACTTGG
- Phenotype
-
- Polymorphism
- T/C, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR13C2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1523678] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR13C2
- Gene Name
- olfactory receptor family 13 subfamily C member 2
There are no transcripts associated with this gene.
- Gene
- OR13C5
- Gene Name
- olfactory receptor family 13 subfamily C member 5
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004482.1 |
810 |
Silent Mutation |
TCA,TCG |
S270S |
NP_001004482.1 |
View Full Product Details