Product Details

SNP ID: rs80343393
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:14804838 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATGTAGCTACTATTTTTAAGATAT[A/G]CTGAGCAGTTTTTATTTCAATACAT
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C12orf60 PubMed Links

Gene Details

Gene: C12orf60
Gene Name: chromosome 12 open reading frame 60

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_175874.3	4581	Intron			NP_787070.2
XM_005253322.4	4581	Intron			XP_005253379.1
XM_011520568.2	4581	Intron			XP_011518870.1
XM_011520569.2	4581	Intron			XP_011518871.1
XM_017018871.1	4581	Intron			XP_016874360.1
XM_017018872.1	4581	Intron			XP_016874361.1
XM_017018873.1	4581	Intron			XP_016874362.1
XM_017018874.1	4581	Intron			XP_016874363.1

Gene: SMCO3
Gene Name: single-pass membrane protein with coiled-coil domains 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013698.2	4581	UTR 3			NP_001013720.2
XM_017019312.1	4581	UTR 3			XP_016874801.1

Gene: WBP11
Gene Name: WW domain binding protein 11

There are no transcripts associated with this gene.

View Full Product Details