Product Details

SNP ID: rs75142051
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30185377 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTGATCTGTGAGGCCAGCGGGGG[A/G]GGGGCCTTCCTGGTGCTGCCCCTGG
Phenotype: MIM: 605000 MIM: 615822
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BOLA2B PubMed Links

Gene Details

Gene: BOLA2B
Gene Name: bolA family member 2B

There are no transcripts associated with this gene.

Gene: CORO1A
Gene Name: coronin 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193333.2	603	Silent Mutation	GGA,GGG	G56G	NP_001180262.1
NM_007074.3	603	Silent Mutation	GGA,GGG	G56G	NP_009005.1
XM_011545714.2	603	Silent Mutation	GGA,GGG	G56G	XP_011544016.1
XM_017022885.1	603	Silent Mutation	GGA,GGG	G56G	XP_016878374.1
XM_017022886.1	603	Silent Mutation	GGA,GGG	G56G	XP_016878375.1

Gene: SLX1A
Gene Name: SLX1 homolog A, structure-specific endonuclease subunit

There are no transcripts associated with this gene.

Gene: SLX1A-SULT1A3
Gene Name: SLX1A-SULT1A3 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details