Product Details

SNP ID: rs75193761
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67199340 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGCTGGACCATGGCGCCTCCGC[A/G]GAACGTGGTGAAGATTGCCATCAAG
Phenotype: MIM: 600659 MIM: 606422 MIM: 614117 MIM: 613701
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: E2F4 PubMed Links

Gene Details

Gene: E2F4
Gene Name: E2F transcription factor 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001950.3	216	Intron			NP_001941.2

Gene: ELMO3
Gene Name: engulfment and cell motility 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024712.3	216	Missense Mutation	CAG,CGG	Q58R	NP_078988.2

Gene: EXOC3L1
Gene Name: exocyst complex component 3 like 1

There are no transcripts associated with this gene.

Gene: LRRC29
Gene Name: leucine rich repeat containing 29

There are no transcripts associated with this gene.

Gene: MIR328
Gene Name: microRNA 328

There are no transcripts associated with this gene.

View Full Product Details