Product Details

SNP ID: rs75681248
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:10823143 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAATGCAAGAGTAATATTATAGGGC[C/T]ATCAAATCTGCATTCATCTCAGAAG
Phenotype: MIM: 612068
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PIRT PubMed Links

Gene Details

Gene: PIRT
Gene Name: phosphoinositide interacting regulator of transient receptor potential channels

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001101387.1	2798	UTR 3			NP_001094857.1

There are no transcripts associated with this gene.