Product Details

SNP ID: rs77809861
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:6416905 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTCTGCAAGACAAGAGGAGGAGGA[G/T]GATGATGAACCCTGGAAGCCGGTCT
Phenotype: MIM: 603445 MIM: 610822
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: KHSRP PubMed Links

Gene Details

Gene: KHSRP
Gene Name: KH-type splicing regulatory protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003685.2		Intron			NP_003676.2
XM_005259668.4		Intron			XP_005259725.1
XM_011528395.2		Intron			XP_011526697.1
XM_017027408.1		Intron			XP_016882897.1
XM_017027409.1		Intron			XP_016882898.1
XM_017027410.1		Intron			XP_016882899.1

Gene: LOC390877
Gene Name: adenylate kinase isoenzyme 1-like

There are no transcripts associated with this gene.

Gene: MIR3940
Gene Name: microRNA 3940

There are no transcripts associated with this gene.

Gene: SLC25A41
Gene Name: solute carrier family 25 member 41

There are no transcripts associated with this gene.

View Full Product Details