Product Details

SNP ID: rs79769971
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:10546995 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAACGCCGGCACCGGCAGATTGTGT[A/C]CTGGTTCGCCGACCACCCCCGGGCC
Phenotype: MIM: 611340
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ATG4D PubMed Links

Gene Details

Gene: ATG4D
Gene Name: autophagy related 4D cysteine peptidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281504.1	847	Missense Mutation	TAC,TCC	Y154S	NP_001268433.1
NM_032885.5	847	Missense Mutation	TAC,TCC	Y217S	NP_116274.3
XM_006722927.1	847	Intron			XP_006722990.1

Gene: KRI1
Gene Name: KRI1 homolog

There are no transcripts associated with this gene.

Gene: MIR1238
Gene Name: microRNA 1238

There are no transcripts associated with this gene.

View Full Product Details