Product Details

SNP ID: rs75929315
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12688950 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAACATGTCAGGTTTATTTCTCCTT[C/T]GCTCTCAACTGAGAGCGGGGCATCC
Phenotype: MIM: 600944 MIM: 609074
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DHPS PubMed Links

Gene Details

Gene: DHPS
Gene Name: deoxyhypusine synthase

There are no transcripts associated with this gene.

Gene: FBXW9
Gene Name: F-box and WD repeat domain containing 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032301.2	1822	UTR 3			NP_115677.2
XM_005260096.4	1822	UTR 3			XP_005260153.1

Gene: LOC105372280
Gene Name: uncharacterized LOC105372280

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316692.1	1822	Intron			NP_001303621.1

View Full Product Details