Product Details

SNP ID

rs74404969

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.20:20052678 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CATCCCCAGGTCAGCCTCCGGAACT[A/G]GGATGACCAGGCGAGGACGAGTGGC

Phenotype

MIM: 610952

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

CFAP61 PubMed Links

Additional Information

For this assay, SNP(s) [rs2273058] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CFAP61

Gene Name

cilia and flagella associated protein 61

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001167816.1	180	Intron			NP_001161288.1
NM_015585.3	180	Intron			NP_056400.3
XM_005260688.3	180	Intron			XP_005260745.1
XM_005260689.2	180	Intron			XP_005260746.1
XM_005260690.3	180	Intron			XP_005260747.1
XM_005260691.3	180	Intron			XP_005260748.1
XM_005260692.3	180	Intron			XP_005260749.1
XM_005260693.3	180	Intron			XP_005260750.1
XM_005260695.4	180	Intron			XP_005260752.1
XM_005260696.4	180	Intron			XP_005260753.1
XM_005260697.1	180	Intron			XP_005260754.1
XM_011529211.1	180	Intron			XP_011527513.1
XM_011529212.2	180	Intron			XP_011527514.1
XM_011529213.1	180	Intron			XP_011527515.1
XM_017027786.1	180	Intron			XP_016883275.1
XM_017027787.1	180	Intron			XP_016883276.1
XM_017027788.1	180	Intron			XP_016883277.1
XM_017027789.1	180	Intron			XP_016883278.1
XM_017027790.1	180	Intron			XP_016883279.1
XM_017027791.1	180	Intron			XP_016883280.1
XM_017027792.1	180	Intron			XP_016883281.1
XM_017027793.1	180	Intron			XP_016883282.1
XM_017027794.1	180	Intron			XP_016883283.1
XM_017027795.1	180	Intron			XP_016883284.1

Gene

CRNKL1

Gene Name

crooked neck pre-mRNA splicing factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278625.1	180	Nonsense Mutation	CAG,TAG	Q38*	NP_001265554.1
NM_001278626.1	180	UTR 5			NP_001265555.1
NM_001278627.1	180	Intron			NP_001265556.1
NM_001278628.1	180	Intron			NP_001265557.1
NM_016652.5	180	Nonsense Mutation	CAG,TAG	Q50*	NP_057736.4

View Full Product Details