Product Details
- SNP ID
-
rs76926692
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:87310276 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCTCAGAAAGATATTGATATACGAT[G/T]GAACAAAAATCATTTTCTTATTGGT
- Phenotype
-
MIM: 612127
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
HSD17B13
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs62305723] are located under a probe and SNP(s) [rs72613567] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HSD17B13
- Gene Name
- hydroxysteroid 17-beta dehydrogenase 13
- Gene
- MIR5705
- Gene Name
- microRNA 5705
There are no transcripts associated with this gene.
View Full Product Details