Product Details

SNP ID: rs75259705
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.4:166734925 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTGATTTCAACTGTCATCAATCAA[A/T]TGTATACATCATGGTCATCACCACC
Phenotype: MIM: 607989
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: SPOCK3 PubMed Links
Additional Information: For this assay, SNP(s) [rs1057377] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: SPOCK3
Gene Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040159.1	1334	Missense Mutation	AAT,ATT	N433I	NP_001035249.1
NM_001204352.1	1334	Missense Mutation	AAT,ATT	N385I	NP_001191281.1
NM_001204353.1	1334	Missense Mutation	AAT,ATT	N316I	NP_001191282.1
NM_001204354.1	1334	Missense Mutation	AAT,ATT	N344I	NP_001191283.1
NM_001204355.1	1334	Missense Mutation	AAT,ATT	N340I	NP_001191284.1
NM_001204356.1	1334	Missense Mutation	AAT,ATT	N393I	NP_001191285.1
NM_001204358.1	1334	Intron			NP_001191287.1
NM_001251967.1	1334	Missense Mutation	AAT,ATT	N338I	NP_001238896.1
NM_016950.2	1334	Missense Mutation	AAT,ATT	N436I	NP_058646.2
XM_011532018.1	1334	Missense Mutation	AAT,ATT	N436I	XP_011530320.1
XM_017008257.1	1334	Missense Mutation	AAT,ATT	N445I	XP_016863746.1
XM_017008258.1	1334	Missense Mutation	AAT,ATT	N433I	XP_016863747.1