Product Details

SNP ID: rs77810659
Assay Type: Functionally tested
NCBI dbSNP Submissions: 21
Location: Chr.1:6630052 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGAAGTAGATGGGTCCCTAGCTCT[A/G]CAGGGACCTATTCAGGGCACTCTGA
Phenotype: MIM: 614827 MIM: 612532
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC11 PubMed Links

Gene Details

Gene: DNAJC11
Gene Name: DnaJ heat shock protein family (Hsp40) member C11

There are no transcripts associated with this gene.

Gene: PHF13
Gene Name: PHD finger protein 13

There are no transcripts associated with this gene.

Gene: THAP3
Gene Name: THAP domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195752.1		Intron			NP_001182681.1
NM_001195753.1		Intron			NP_001182682.1
NM_138350.3		Intron			NP_612359.2
XM_005263532.3		Intron			XP_005263589.1
XM_011542400.2		Intron			XP_011540702.1
XM_011542401.2		Intron			XP_011540703.1
XM_017002761.1		Intron			XP_016858250.1

View Full Product Details