Product Details

SNP ID: rs77576319
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:96325607 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGGTCCCGGGAGACATCCCGAGGT[A/G]GGATGGGCCCTTGGCCTCCTACGGA
Phenotype: MIM: 601664
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ITPRIPL1 PubMed Links

Gene Details

Gene: ITPRIPL1
Gene Name: inositol 1,4,5-trisphosphate receptor interacting protein-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008949.2	36	Intron			NP_001008949.1
NM_001163523.1	36	Intron			NP_001156995.1
NM_001163524.1	36	Intron			NP_001156996.1
NM_001324490.1	36	Intron			NP_001311419.1
NM_178495.5	36	Intron			NP_848590.3
XM_017003427.1	36	UTR 5			XP_016858916.1

Gene: LOC105373495
Gene Name: uncharacterized LOC105373495

There are no transcripts associated with this gene.

Gene: SNRNP200
Gene Name: small nuclear ribonucleoprotein U5 subunit 200

There are no transcripts associated with this gene.

View Full Product Details