Product Details

SNP ID
rs75597542
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.5:179616196 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCCCACTCAGCTGCTGGCTGGCTGG[A/G]CCCCCGTAGCTGGACTGGTTTGCTG
Phenotype
MIM: 601035 MIM: 610327
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
HNRNPH1 PubMed Links

Gene Details

Gene
HNRNPH1
Gene Name
heterogeneous nuclear ribonucleoprotein H1 (H)
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001257293.1 1185 Silent Mutation GGC,GGT G410G NP_001244222.1
NM_005520.2 1185 Intron NP_005511.1
XM_005265895.2 1185 Silent Mutation GGC,GGT G410G XP_005265952.1
XM_005265896.2 1185 Silent Mutation GGC,GGT G410G XP_005265953.1
XM_005265901.1 1185 Silent Mutation GGC,GGT G209G XP_005265958.1
XM_005265902.4 1185 Silent Mutation GGC,GGT G209G XP_005265959.1
XM_006714862.2 1185 Silent Mutation GGC,GGT G390G XP_006714925.1
XM_006714863.2 1185 Silent Mutation GGC,GGT G390G XP_006714926.1
XM_011534542.1 1185 Silent Mutation GGC,GGT G410G XP_011532844.1
XM_011534544.1 1185 Silent Mutation GGC,GGT G410G XP_011532846.1
XM_011534545.1 1185 Silent Mutation GGC,GGT G410G XP_011532847.1
XM_011534546.1 1185 Silent Mutation GGC,GGT G410G XP_011532848.1
XM_011534547.1 1185 Silent Mutation GGC,GGT G400G XP_011532849.1
XM_017009414.1 1185 Silent Mutation GGC,GGT G390G XP_016864903.1
XM_017009415.1 1185 Silent Mutation GGC,GGT G410G XP_016864904.1
XM_017009416.1 1185 Silent Mutation GGC,GGT G410G XP_016864905.1
XM_017009417.1 1185 Silent Mutation GGC,GGT G410G XP_016864906.1
XM_017009418.1 1185 Silent Mutation GGC,GGT G400G XP_016864907.1
XM_017009419.1 1185 Silent Mutation GGC,GGT G390G XP_016864908.1
XM_017009420.1 1185 Silent Mutation GGC,GGT G189G XP_016864909.1
XM_017009421.1 1185 Silent Mutation GGC,GGT G209G XP_016864910.1
XM_017009422.1 1185 Silent Mutation GGC,GGT G209G XP_016864911.1
XM_017009423.1 1185 Silent Mutation GGC,GGT G199G XP_016864912.1
XM_017009424.1 1185 Silent Mutation GGC,GGT G227G XP_016864913.1
XM_017009425.1 1185 Intron XP_016864914.1
Gene
RUFY1
Gene Name
RUN and FYVE domain containing 1
There are no transcripts associated with this gene.

View Full Product Details