Product Details

SNP ID
rs78795662
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.5:179617892 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCTGGAAAGTAGAGCCACCATCCCC[A/G]TATCTGTGATCAGACATTCCTGAAA
Phenotype
MIM: 601035 MIM: 610327
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
HNRNPH1 PubMed Links

Gene Details

Gene
HNRNPH1
Gene Name
heterogeneous nuclear ribonucleoprotein H1 (H)
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001257293.1 783 Silent Mutation TAC,TAT Y276Y NP_001244222.1
NM_005520.2 783 Intron NP_005511.1
XM_005265895.2 783 Silent Mutation TAC,TAT Y276Y XP_005265952.1
XM_005265896.2 783 Silent Mutation TAC,TAT Y276Y XP_005265953.1
XM_005265901.1 783 Silent Mutation TAC,TAT Y75Y XP_005265958.1
XM_005265902.4 783 Silent Mutation TAC,TAT Y75Y XP_005265959.1
XM_006714862.2 783 Silent Mutation TAC,TAT Y276Y XP_006714925.1
XM_006714863.2 783 Silent Mutation TAC,TAT Y276Y XP_006714926.1
XM_011534542.1 783 Silent Mutation TAC,TAT Y276Y XP_011532844.1
XM_011534544.1 783 Silent Mutation TAC,TAT Y276Y XP_011532846.1
XM_011534545.1 783 Silent Mutation TAC,TAT Y276Y XP_011532847.1
XM_011534546.1 783 Silent Mutation TAC,TAT Y276Y XP_011532848.1
XM_011534547.1 783 Silent Mutation TAC,TAT Y276Y XP_011532849.1
XM_017009414.1 783 Silent Mutation TAC,TAT Y276Y XP_016864903.1
XM_017009415.1 783 Silent Mutation TAC,TAT Y276Y XP_016864904.1
XM_017009416.1 783 Silent Mutation TAC,TAT Y276Y XP_016864905.1
XM_017009417.1 783 Silent Mutation TAC,TAT Y276Y XP_016864906.1
XM_017009418.1 783 Silent Mutation TAC,TAT Y276Y XP_016864907.1
XM_017009419.1 783 Silent Mutation TAC,TAT Y276Y XP_016864908.1
XM_017009420.1 783 Silent Mutation TAC,TAT Y75Y XP_016864909.1
XM_017009421.1 783 Silent Mutation TAC,TAT Y75Y XP_016864910.1
XM_017009422.1 783 Silent Mutation TAC,TAT Y75Y XP_016864911.1
XM_017009423.1 783 Silent Mutation TAC,TAT Y75Y XP_016864912.1
XM_017009424.1 783 Silent Mutation TAC,TAT Y113Y XP_016864913.1
XM_017009425.1 783 Intron XP_016864914.1
Gene
RUFY1
Gene Name
RUN and FYVE domain containing 1
There are no transcripts associated with this gene.

View Full Product Details