Product Details

SNP ID: rs74990919
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:99433774 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCAGCACTGTGACTGACTCATAGC[A/G]AGTATGGGTATCTATCCAAATATTT
Phenotype: MIM: 616653
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: LOC101927365 PubMed Links

Gene Details

Gene: LOC101927365
Gene Name: uncharacterized LOC101927365

There are no transcripts associated with this gene.

Gene: PNISR
Gene Name: PNN interacting serine and arginine rich protein

There are no transcripts associated with this gene.

Gene: TSTD3
Gene Name: thiosulfate sulfurtransferase (rhodanese)-like domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195131.1	3803	Intron			NP_001182060.1
XM_017010141.1	3803	Intron			XP_016865630.1

Gene: USP45
Gene Name: ubiquitin specific peptidase 45

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080481.1	3803	UTR 3			NP_001073950.1
XM_005267169.3	3803	UTR 3			XP_005267226.1
XM_005267170.4	3803	UTR 3			XP_005267227.1
XM_005267172.3	3803	UTR 3			XP_005267229.1
XM_005267175.3	3803	Intron			XP_005267232.1
XM_011536200.2	3803	UTR 3			XP_011534502.1
XM_017011381.1	3803	UTR 3			XP_016866870.1
XM_017011382.1	3803	UTR 3			XP_016866871.1
XM_017011383.1	3803	UTR 3			XP_016866872.1
XM_017011384.1	3803	UTR 3			XP_016866873.1
XM_017011385.1	3803	Intron			XP_016866874.1
XM_017011386.1	3803	Intron			XP_016866875.1

View Full Product Details