Product Details
- SNP ID
-
rs76224672
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.10:104123449 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGGAGTACTATCAGGCATGTGCTT[G/T]TTACTGAACAAATGTTCCTTGATTA
- Phenotype
-
MIM: 616527
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CFAP43
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs541090091] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CFAP43
- Gene Name
- cilia and flagella associated protein 43
There are no transcripts associated with this gene.
- Gene
- SFR1
- Gene Name
- SWI5 dependent homologous recombination repair protein 1
View Full Product Details