Product Details

SNP ID: rs75362566
Assay Type: Functionally tested
NCBI dbSNP Submissions: 15
Location: Chr.1:83866912 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAAGTGATGATTTAAAATAAAAAAG[A/G]TTGTTTCTTAGACATTTCTAGAAAT
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101927560 PubMed Links

Gene Details

Gene: LOC101927560
Gene Name: uncharacterized LOC101927560

There are no transcripts associated with this gene.

Gene: LOC101927587
Gene Name: uncharacterized LOC101927587

There are no transcripts associated with this gene.

Gene: TTLL7
Gene Name: tubulin tyrosine ligase like 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024686.4	5885	Intron			NP_078962.4
XM_005271208.2	5885	UTR 3			XP_005271265.1
XM_011542159.2	5885	Intron			XP_011540461.1
XM_017002347.1	5885	UTR 3			XP_016857836.1
XM_017002348.1	5885	Intron			XP_016857837.1
XM_017002349.1	5885	UTR 3			XP_016857838.1

View Full Product Details