Product Details
- SNP ID
-
rs77234880
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:7637184 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCGGGGCTGAAGGCGGTGGTGGGGG[A/G]AAGTGAGTGCCTCTCCGGGGCCGGG
- Phenotype
-
MIM: 614770
MIM: 601717
MIM: 610850
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PCP2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs150025014] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PCP2
- Gene Name
- Purkinje cell protein 2
- Gene
- PET100
- Gene Name
- PET100 homolog
There are no transcripts associated with this gene.
- Gene
- STXBP2
- Gene Name
- syntaxin binding protein 2
- Gene
- XAB2
- Gene Name
- XPA binding protein 2
There are no transcripts associated with this gene.
View Full Product Details