Product Details

SNP ID: rs76488663
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65891318 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCCCGTGCGGGCCCCGCGACCTA[G/T]GCGATGGAAGCTCCAGCACTGGCAG
Phenotype: MIM: 605360 MIM: 602364 MIM: 608296 MIM: 136515
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CCDC85B PubMed Links

Gene Details

Gene: CCDC85B
Gene Name: coiled-coil domain containing 85B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006848.2	915	Missense Mutation	GGC,TGC	G179C	NP_006839.2

Gene: CTSW
Gene Name: cathepsin W

There are no transcripts associated with this gene.

Gene: FIBP
Gene Name: FGF1 intracellular binding protein

There are no transcripts associated with this gene.

Gene: FOSL1
Gene Name: FOS like 1, AP-1 transcription factor subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300844.1	915	Intron			NP_001287773.1
NM_001300855.1	915	Intron			NP_001287784.1
NM_001300856.1	915	Intron			NP_001287785.1
NM_001300857.1	915	Intron			NP_001287786.1
NM_005438.4	915	Intron			NP_005429.1

View Full Product Details