Product Details

SNP ID: rs114394507
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:89644077 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCGCTGAGTGTCTCAGGAAGTGC[A/G]TTTACATCTCGAAGAATGATATAGT
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101929057 PubMed Links

Gene Details

Gene: LOC101929057
Gene Name: uncharacterized LOC101929057

There are no transcripts associated with this gene.

Gene: LYRM2
Gene Name: LYR motif containing 2

There are no transcripts associated with this gene.

Gene: MDN1
Gene Name: midasin AAA ATPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014611.2	16711	Silent Mutation	AAC,AAT	N5573N	NP_055426.1
XM_005248700.3	16711	Silent Mutation	AAC,AAT	N3568N	XP_005248757.1
XM_006715405.3	16711	Silent Mutation	AAC,AAT	N3721N	XP_006715468.1
XM_011535635.2	16711	Silent Mutation	AAC,AAT	N5476N	XP_011533937.1
XM_011535636.2	16711	Intron			XP_011533938.1

View Full Product Details