Product Details

SNP ID: rs116014003
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:151048929 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGAGGAGGCCCGGCGGCCAGCCT[C/T]GGACATCCGCGTGTTCGCCAGCAAC
Phenotype: MIM: 605464 MIM: 611741 MIM: 123831 MIM: 109280
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ABCB8 PubMed Links

Gene Details

Gene: ABCB8
Gene Name: ATP binding cassette subfamily B member 8

There are no transcripts associated with this gene.

Gene: ASIC3
Gene Name: acid sensing ion channel subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004769.3	638	Missense Mutation	TCG,TTG	S15L	NP_004760.1
NM_020321.3	638	Missense Mutation	TCG,TTG	S15L	NP_064717.1
NM_020322.3	638	Missense Mutation	TCG,TTG	S15L	NP_064718.1

Gene: CDK5
Gene Name: cyclin dependent kinase 5

There are no transcripts associated with this gene.

Gene: SLC4A2
Gene Name: solute carrier family 4 member 2

There are no transcripts associated with this gene.

View Full Product Details