Product Details

SNP ID: rs114080127
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6482167 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCATCGCAGACTACGAGGCTGCCTC[C/G]GCTGTGCCAGGCGTTGCTGCTGAAC
Phenotype: MIM: 601638 MIM: 607388 MIM: 605493
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ARFIP2 PubMed Links

Gene Details

Gene: ARFIP2
Gene Name: ADP ribosylation factor interacting protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242854.1	328	Intron			NP_001229783.1
NM_001242855.1	328	Intron			NP_001229784.1
NM_001242856.1	328	Intron			NP_001229785.1
NM_012402.3	328	Intron			NP_036534.1
XM_005252840.4	328	Intron			XP_005252897.1

Gene: TIMM10B
Gene Name: translocase of inner mitochondrial membrane 10 homolog B (yeast)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012192.3	328	Silent Mutation	TCC,TCG	S86S	NP_036324.1

Gene: TRIM3
Gene Name: tripartite motif containing 3

There are no transcripts associated with this gene.

View Full Product Details