Product Details

SNP ID: rs121908832
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:822407 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGTCCCGTGGAAGCGCTACGTGG[A/G]TGGTGGCATTTCAGACAACCTGCCA
Phenotype: MIM: 614177 MIM: 609059 MIM: 180530
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CRACR2B PubMed Links

Gene Details

Gene: CRACR2B
Gene Name: calcium release activated channel regulator 2B

There are no transcripts associated with this gene.

Gene: PNPLA2
Gene Name: patatin like phospholipase domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020376.3	646	Missense Mutation	GAT,GGT	D166G	NP_065109.1
XM_006718265.3	646	Missense Mutation	GAT,GGT	D166G	XP_006718328.1
XM_006718266.3	646	Missense Mutation	GAT,GGT	D166G	XP_006718329.1
XM_017018028.1	646	Missense Mutation	GAT,GGT	D166G	XP_016873517.1

Gene: RPLP2
Gene Name: ribosomal protein lateral stalk subunit P2

There are no transcripts associated with this gene.

View Full Product Details