Product Details

SNP ID: rs112716013
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:110715615 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGACGAGTTGATTTGAACGTCTTC[G/T]GGTCGCTCGGCCTCCAGCCTTGGAT
Phenotype: MIM: 612800 MIM: 601566
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CARS2 PubMed Links

Gene Details

Gene: CARS2
Gene Name: cysteinyl-tRNA synthetase 2, mitochondrial (putative)

There are no transcripts associated with this gene.

Gene: ING1
Gene Name: inhibitor of growth family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267728.1	604	Intron			NP_001254657.1
NM_005537.5	604	Missense Mutation	GGG,TGG	G58W	NP_005528.4
NM_198217.2	604	Intron			NP_937860.1
NM_198218.2	604	Intron			NP_937861.1
NM_198219.2	604	Intron			NP_937862.1

Gene: LOC105376684
Gene Name: translation initiation factor IF-2-like

There are no transcripts associated with this gene.

View Full Product Details